| ALX-746-026-C100 | 100 µg | 310.00 USD |  |
||
| Do you need bulk/larger quantities? | |||||
| Sequence: | TTAACAATTTTTACCCAAGA Nucleotides depicted in italics show the corresponding AT-ODN sequence. |
| MW: | 6382 |
| Source: | Synthetic. |
| Quantity: | 15.7nmol |
| Formulation: | Lyophilized. Sterile. |
| Endotoxin Content: | <0.0002EU/µg (LAL test; BioWhittaker) |
| Reconstitution: | For a 100µM stock solution, dissolve the total vial content in 157µl endotoxin-free water (included) or PBS (to order separately). To obtain optimal dissolving we recommend the following procedure: - Add 50% of the solvent and let dissolve for 10 min. - Add remaining 50% of the solvent and mix thoroughly. - Moderate warming may aid dissolving. |
| Shipping: | Ambient Temperature |
| Long Term Storage: | +4°C |
| Use/Stability: | Aqueous stock solution is stable for 1 day when stored at +4°C. |
| Handling: | Protect from light. For maximum product recovery after thawing, centrifuge the vial before opening the cap. After reconstitution, prepare aliquots and store at -20°C. |
| Scientific Background: | CpG ODNs are well known for their immunostimulatory effect mediated by the activation of TLR9. It has been shown that not only CpG ODNs but also some AT-rich DNA fragments (AT-ODNs) are able to exert this effect. AT-ODNs with TLR9-activating and immunostimulatory properties were identified in Lactobacillus gasseri as well as in the malarial pathogen Plasmodium falciparum. AT-ODNs are useful tools for studying the role of TLR9 in the innate immunological response and in inflammation. |
| Technical Info/Product Notes: | Includes 1 vial of ddWater (endotoxin-free) (Prod. No. ALX-505-008). |
| Regulatory Status: | RUO - Research Use Only |
PBS (endotoxin-free) (sterile) |
||||||
| Print as PDF | ||||||
| ALX-505-007-LD15 | 1.5 ml | 66.00 USD | |
|||
| ALX-505-007-L010 | 10 ml | 129.00 USD | |
|||
| Do you need bulk/larger quantities? | ||||||
ddWater (endotoxin-free) (sterile) |
||||||
| 7732-18-5 | Print as PDF | ||||||
| ALX-505-008-LD15 | 1.5 ml | 49.00 USD | |
|||
| Do you need bulk/larger quantities? | ||||||
AT-ODN-1 (endotoxin-free) (synthetic) |
||||||
| TLR9 activator | ||||||
| Synthetic. | Print as PDF | ||||||
| ALX-746-024-C100 | 100 µg | 287.00 USD | |
|||
| Do you need bulk/larger quantities? | ||||||
AT-ODN-2 (endotoxin-free) (synthetic) |
||||||
| TLR9 activator | ||||||
| Synthetic. | Print as PDF | ||||||
| ALX-746-025-C100 | 100 µg | 310.00 USD | |
|||
| Do you need bulk/larger quantities? | ||||||
