Lactobacillus gasseri-derived non-CpG ODN of the AT-type; TLR9 (Toll-like receptor 9)-dependent immune activation.
Product Details
Sequence: | TATAATTTTTACCAACTAGC Nucleotides depicted in italics show the corresponding AT-ODN sequence. |
|
MW: | 6374 |
|
Source: | Synthetic. |
|
Quantity: | 15.8nmol |
|
Formulation: | Lyophilized. Sterile. |
|
Endotoxin Content: | <0.0002EU/µg (LAL test; BioWhittaker) |
|
Reconstitution: | For a 100µM stock solution, dissolve the total vial content in 158µl endotoxin-free water (included) or PBS (to order separately). To obtain optimal dissolving we recommend the following procedure:
- Add 50% of the solvent and let dissolve for 10 min.
- Add remaining 50% of the solvent and mix thoroughly.
- Moderate warming may aid dissolving. |
|
Shipping: | Ambient Temperature |
|
Long Term Storage: | +4°C |
|
Use/Stability: | Aqueous stock solution is stable for 1 day when stored at +4°C. |
|
Handling: | Protect from light. For maximum product recovery after thawing, centrifuge the vial before opening the cap. After reconstitution, prepare aliquots and store at -20°C. |
|
Scientific Background: | CpG ODNs are well known for their immunostimulatory effect mediated by the activation of TLR9. It has been shown that not only CpG ODNs but also some AT-rich DNA fragments (AT-ODNs) are able to exert this effect. AT-ODNs with TLR9-activating and immunostimulatory properties were identified in Lactobacillus gasseri as well as in the malarial pathogen Plasmodium falciparum. AT-ODNs are useful tools for studying the role of TLR9 in the innate immunological response and in inflammation. |
|
Technical Info/Product Notes: | Includes 1 vial of ddWater (endotoxin-free) (Prod. No. ALX-505-008). |
|
Regulatory Status: | RUO - Research Use Only |
|
Product Literature References
Strong immunostimulatory activity of AT-oligodeoxynucleotide requires a six-base loop with a self-stabilized 5’-C...G-3’ stem structure: T. Shimosato, et al.; Cell. Microbiol.
8, 485 (2006),
Abstract;
Augmentation of T(H)-1 type response by immunoactive AT oligonucleotide from lactic acid bacteria via Toll-like receptor 9 signaling: T. Shimosato, et al.; BBRC
326, 782 (2005),
Abstract;
AT oligonucleotides inducing B lymphocyte activation exist in probiotic Lactobacillus gasseri: H. Kitazawa, et al.; Int. J. Food Microbiol.
65, 149 (2001),
Abstract;
General Literature References
Cutting edge: species-specific TLR9-mediated recognition of CpG and non-CpG phosphorothioate-modified oligonucleotides: T.L. Roberts, et al.; J. Immunol.
174, 605 (2005),
Abstract;
Related Products