Online Purchasing Account You are logged on as Guest. LoginRegister a New AccountShopping cart (Empty)
United States 

AT-ODN-3 (endotoxin-free) (synthetic)

TLR9 activator
 
ALX-746-026-C100 100 µg 276.00 USD
Do you need bulk/larger quantities?
 
Lactobacillus gasseri-derived non-CpG ODN of the AT-type; TLR9 (Toll-like receptor 9)-dependent immune activation.

Product Specification

Sequence:TTAACAATTTTTACCCAAGA Nucleotides depicted in italics show the corresponding AT-ODN sequence.
 
MW:6382
 
Source:Synthetic.
 
Quantity:15.7nmol
 
Formulation:Lyophilized. Sterile.
 
Endotoxin Content:<0.0002EU/µg (LAL test; BioWhittaker)
 
Reconstitution:For a 100µM stock solution, dissolve the total vial content in 157µl endotoxin-free water (included) or PBS (to order separately). To obtain optimal dissolving we recommend the following procedure:
- Add 50% of the solvent and let dissolve for 10 min.
- Add remaining 50% of the solvent and mix thoroughly.
- Moderate warming may aid dissolving.
 
Shipping:Ambient
 
Long Term Storage:+4°C
 
Use/Stability:Aqueous stock solution is stable for 1 day when stored at +4°C.
 
Handling:Protect from light. For maximum product recovery after thawing, centrifuge the vial before opening the cap. After reconstitution, prepare aliquots and store at -20°C.
 
Scientific Background:CpG ODNs are well known for their immunostimulatory effect mediated by the activation of TLR9. It has been shown that not only CpG ODNs but also some AT-rich DNA fragments (AT-ODNs) are able to exert this effect. AT-ODNs with TLR9-activating and immunostimulatory properties were identified in Lactobacillus gasseri as well as in the malarial pathogen Plasmodium falciparum. AT-ODNs are useful tools for studying the role of TLR9 in the innate immunological response and in inflammation.
 
Technical Info/Product Notes:Includes 1 vial of ddWater (endotoxin-free) (Prod. No. ALX-505-008).
 

Product Literature References

Strong immunostimulatory activity of AT-oligodeoxynucleotide requires a six-base loop with a self-stabilized 5’-C...G-3’ stem structure: T. Shimosato, et al.; Cell. Microbiol. 8, 485 (2006), Abstract;
Augmentation of T(H)-1 type response by immunoactive AT oligonucleotide from lactic acid bacteria via Toll-like receptor 9 signaling: T. Shimosato, et al.; BBRC 326, 782 (2005), Abstract;
AT oligonucleotides inducing B lymphocyte activation exist in probiotic Lactobacillus gasseri: H. Kitazawa, et al.; Int. J. Food Microbiol. 65, 149 (2001), Abstract;

General Literature References

Cutting edge: species-specific TLR9-mediated recognition of CpG and non-CpG phosphorothioate-modified oligonucleotides: T.L. Roberts, et al.; J. Immunol. 174, 605 (2005), Abstract;

Related Products

PBS (endotoxin-free) (sterile) 

Print as PDF
 
ALX-505-007-LD15 1.5 ml 56.00 USD
 
ALX-505-007-L010 10 ml 107.00 USD
Do you need bulk/larger quantities?
 

ddWater (endotoxin-free) (sterile) 

7732-18-5 | Print as PDF
 
ALX-505-008-LD15 1.5 ml 40.00 USD
Do you need bulk/larger quantities?
 

AT-ODN-1 (endotoxin-free) (synthetic) 

TLR9 activator
Synthetic. | Print as PDF
 
ALX-746-024-C100 100 µg 255.00 USD
Do you need bulk/larger quantities?
 

AT-ODN-2 (endotoxin-free) (synthetic) 

TLR9 activator
Synthetic. | Print as PDF
 
ALX-746-025-C100 100 µg 276.00 USD
Do you need bulk/larger quantities?
 

Product Toolbox

PRODUCT RESOURCES

Datasheet
MSDS
Certificate of Analysis

RELATED PRODUCTS

By target:
TLR
TLR9
By biological activity:
TLR Activator
TLR Ligand
TLR9 Activator
TLR9 Ligand
By catalog section:

PRODUCT SUPPORT

FAQs
Technical Service
Customer Service

Recommend this page

 
For Research Use Only. Not for use in diagnostic procedures.
Keep in touch

©2019 Enzo Life Sciences, Inc.,