Online Purchasing Account You are logged on as Guest. LoginRegister a New AccountShopping cart (Empty)
United States 

AT-ODN-3 (endotoxin-free) (synthetic)

TLR9 activator
 
ALX-746-026-C100 100 µg 271.00 USD
Do you need bulk/larger quantities?
 
Lactobacillus gasseri-derived non-CpG ODN of the AT-type; TLR9 (Toll-like receptor 9)-dependent immune activation.

Product Specification

Sequence:TTAACAATTTTTACCCAAGA Nucleotides depicted in italics show the corresponding AT-ODN sequence.
 
MW:6382
 
Source:Synthetic.
 
Quantity:15.7nmol
 
Formulation:Lyophilized. Sterile.
 
Endotoxin Content:<0.0002EU/µg (LAL test; BioWhittaker)
 
Reconstitution:For a 100µM stock solution, dissolve the total vial content in 157µl endotoxin-free water (included) or PBS (to order separately). To obtain optimal dissolving we recommend the following procedure:
- Add 50% of the solvent and let dissolve for 10 min.
- Add remaining 50% of the solvent and mix thoroughly.
- Moderate warming may aid dissolving.
 
Shipping:Ambient
 
Long Term Storage:+4°C
 
Use/Stability:Aqueous stock solution is stable for 1 day when stored at +4°C.
 
Handling:Protect from light. For maximum product recovery after thawing, centrifuge the vial before opening the cap. After reconstitution, prepare aliquots and store at -20°C.
 
Scientific Background:CpG ODNs are well known for their immunostimulatory effect mediated by the activation of TLR9. It has been shown that not only CpG ODNs but also some AT-rich DNA fragments (AT-ODNs) are able to exert this effect. AT-ODNs with TLR9-activating and immunostimulatory properties were identified in Lactobacillus gasseri as well as in the malarial pathogen Plasmodium falciparum. AT-ODNs are useful tools for studying the role of TLR9 in the innate immunological response and in inflammation.
 
Technical Info/Product Notes:Includes 1 vial of ddWater (endotoxin-free) (Prod. No. ALX-505-008).
 

Product Literature References

Strong immunostimulatory activity of AT-oligodeoxynucleotide requires a six-base loop with a self-stabilized 5’-C...G-3’ stem structure: T. Shimosato, et al.; Cell. Microbiol. 8, 485 (2006), Abstract;
Augmentation of T(H)-1 type response by immunoactive AT oligonucleotide from lactic acid bacteria via Toll-like receptor 9 signaling: T. Shimosato, et al.; BBRC 326, 782 (2005), Abstract;
AT oligonucleotides inducing B lymphocyte activation exist in probiotic Lactobacillus gasseri: H. Kitazawa, et al.; Int. J. Food Microbiol. 65, 149 (2001), Abstract;

General Literature References

Cutting edge: species-specific TLR9-mediated recognition of CpG and non-CpG phosphorothioate-modified oligonucleotides: T.L. Roberts, et al.; J. Immunol. 174, 605 (2005), Abstract;

Related Products

PBS (endotoxin-free) 

Print as PDF
 
ALX-505-007-LD15 1.5 ml 54.00 USD
 
ALX-505-007-L010 10 ml 102.00 USD
Do you need bulk/larger quantities?
 

ddWater (endotoxin-free) 

7732-18-5 | Print as PDF
 
ALX-505-008-LD15 1.5 ml 38.00 USD
Do you need bulk/larger quantities?
 

AT-ODN-1 (endotoxin-free) (synthetic) 

TLR9 activator
Synthetic. | Print as PDF
 
ALX-746-024-C100 100 µg 250.00 USD
Do you need bulk/larger quantities?
 

AT-ODN-2 (endotoxin-free) (synthetic) 

TLR9 activator
Synthetic. | Print as PDF
 
ALX-746-025-C100 100 µg 271.00 USD
Do you need bulk/larger quantities?
 

Product Toolbox

PRODUCT RESOURCES

Datasheet
MSDS
Certificate of Analysis

RELATED PRODUCTS

By target:
TLR
TLR9
By biological activity:
TLR Activator
TLR Ligand
TLR9 Activator
TLR9 Ligand
By catalog section:

PRODUCT SUPPORT

FAQs
Technical Service
Customer Service

Related Literature

Product Flyers
Antiviral Signaling
Antiviral Signaling
Download as PDF

Product Flyers
Key TLR Ligands and their Receptors
Key TLR Ligands and their Receptors
Download as PDF

All new literature pieces

Recommend this page

 
For Research Use Only. Not for use in diagnostic procedures.
Keep in touch

©2017 Enzo Life Sciences, Inc.,