Online Purchasing Account You are logged on as Guest. LoginRegister a New AccountShopping cart (Empty)
United States 

AT-ODN-1 (endotoxin-free) (synthetic)

TLR9 activator
ALX-746-024-C100 100 µg 255.00 USD
Do you need bulk/larger quantities?
IFN-γ inducing non-CpG ODN of the AT-type, found in the Malaria genome; TLR9 (Toll-like receptor 9)-dependent immune activation.

Product Specification

Sequence:TATAATTTTAATTTCCAAGA Nucleotides depicted in italics show the corresponding AT-ODN sequence.
Formulation:Lyophilized. Sterile.
Endotoxin Content:<0.0002EU/µg (LAL test; BioWhittaker)
Reconstitution:For a 100µM stock solution, dissolve the total vial content in 157µl endotoxin-free water (included) or PBS (to order separately). To obtain optimal dissolving we recommend the following procedure:
- Add 50% of the solvent and let dissolve for 10 min.
- Add remaining 50% of the solvent and mix thoroughly.
- Moderate warming may aid dissolving.
Long Term Storage:+4°C
Use/Stability:Aqueous stock solution is stable for 1 day when stored at +4°C.
Handling:Protect from light. For maximum product recovery after thawing, centrifuge the vial before opening the cap. After reconstitution, prepare aliquots and store at -20°C.
Scientific Background:CpG ODNs are well known for their immunostimulatory effect mediated by the activation of TLR9. It has been shown that not only CpG ODNs but also some AT-rich DNA fragments (AT-ODNs) are able to exert this effect. AT-ODNs with TLR9-activating and immunostimulatory properties were identified in Lactobacillus gasseri as well as in the malarial pathogen Plasmodium falciparum. AT-ODNs are useful tools for studying the role of TLR9 in the innate immunological response and in inflammation.
Technical Info/Product Notes:Includes 1 vial of ddWater (endotoxin-free) (Prod. No. ALX-505-008).

General Literature References

Malaria hemozoin is immunologically inert but radically enhances innate responses by presenting malaria DNA to Toll-like receptor 9: P. Parroche, et al.; PNAS 104, 1919 (2007), Abstract;
Malarial fever: hemozoin is involved but Toll-free: R.R. Schumann; PNAS 104, 1743 (2007), Abstract;
Strong immunostimulatory activity of AT-oligodeoxynucleotide requires a six-base loop with a self-stabilized 5’-C...G-3’ stem structure: T. Shimosato, et al.; Cell. Microbiol. 8, 485 (2006), Abstract;
Augmentation of T(H)-1 type response by immunoactive AT oligonucleotide from lactic acid bacteria via Toll-like receptor 9 signaling: T. Shimosato, et al.; BBRC 326, 782 (2005), Abstract;
AT oligonucleotides inducing B lymphocyte activation exist in probiotic Lactobacillus gasseri: H. Kitazawa, et al.; Int. J. Food. Microbiol. 65, 149 (2001), Abstract;

Related Products

PBS (endotoxin-free) 

Print as PDF
ALX-505-007-LD15 1.5 ml 55.00 USD
ALX-505-007-L010 10 ml 104.00 USD
Do you need bulk/larger quantities?

ddWater (endotoxin-free) 

7732-18-5 | Print as PDF
ALX-505-008-LD15 1.5 ml 39.00 USD
Do you need bulk/larger quantities?

AT-ODN-2 (endotoxin-free) (synthetic) 

TLR9 activator
Synthetic. | Print as PDF
ALX-746-025-C100 100 µg 276.00 USD
Do you need bulk/larger quantities?

AT-ODN-3 (endotoxin-free) (synthetic) 

TLR9 activator
Synthetic. | Print as PDF
ALX-746-026-C100 100 µg 276.00 USD
Do you need bulk/larger quantities?

Product Toolbox


Certificate of Analysis


By target:
By biological activity:
TLR Activator
TLR Ligand
TLR9 Activator
TLR9 Ligand
By catalog section:


Technical Service
Customer Service

Related Literature

Product Flyers
Antiviral Signaling
Antiviral Signaling
Download as PDF

Product Flyers
Key TLR Ligands and their Receptors
Key TLR Ligands and their Receptors
Download as PDF

All new literature pieces

Recommend this page

For Research Use Only. Not for use in diagnostic procedures.
Keep in touch

©2018 Enzo Life Sciences, Inc.,